Numeric Representation of RNA and DNA

Widely accepted representation of RNA/DNA bases are five initial letters of their Latin names Thymine=T, Guanine=G, Adenine=A, Cytosine=C and Uracil=U.  Based on these, in essence arbitrary,  letters this representation  is the least revealing and functional.  From these letters we could  only guess the name of the base, but wont be able to learn anything about the relationships between the bases.

01

Another representation based on five values from the gray scale where T=White(0% black), G=Light(25% black), A=Gray(50% black), C= Dark (75% black) and U=Black(100%  black) much better reflects some properties of  RNA and DNA. Instead of listing all three base-pairs T-A, G-C and A-U,  we could look for all the pairs with 50% value difference and we will get only these three pairs. In addition, we could notice that the  base-pair  relationship is not neutral, but in case G-C it is addition(G+50%=C)  while C-G is a subtraction(C-50%=G).

01a.

It might be interesting to notice that in all six base-pair transactions the exchange value is the same 50% black that is the symbolic value for Adenine. It seems as if Adenine represents an exchange currency  in these transactions.

Based on this visual representation  it is possible to define a corresponding  numeric representation of the bases either  expressed as percentage values as mentioned above:      T=0%, G=25%, A=50%, C=75% , U=100%  or as whole numbers T=0, G=1, A=2, C=3, U=4(DNA 0,1,2, 3 and RNA 1,2,3, 4). Here the  exchange value for the base-pairs is 2 which is also the number that represents Adenine. Thus, instead of  a DNA sequence expressed through alphabet  letters ATAGCATTGATTAGCCCATGGACAGA we could have  its numeric version as 20213200120021333201123212. This numeric representation could be presented in 2D as a Cartesian diagram where  on the x are positions of the bases while on the y are their values. Below are cases of the sequences with high and low entropy as well as a few stretches of human chromosome  Chr22 represented in the numeric form.

Gregor Mobius                                                                       New York,  June 15, 2019

 

11. Numeric DNA

12. Numeric DNA.jpg

13. Numeric DNA

 

************************************

Appendix

20

21

22

23

24

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s