The Oldest Known DNA Sequence

                      

This seems to be the oldest known DNA sequence present in every living organism*).               It existed in the common ancestor of all life and remained unchanged for three billion years.                                                        GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAG

And this would be its visual representation.

Gregor Mobius                                                                                                  March 2020

* * * *

*)  Michael Le Page, A Brief History of the Human Genome. New Scientist, 15 Sept. 2012 p.30

01

20

06 (2)

04

251 (2)

251-123

*  *  *

05

1-3

4-6

*  *  *          06

7-9

10-12

*  *  *

07

13-15

16-18

*  *  *

08

19-21

22-24

*  *  *

09

25-27

28-30

*  *  *

10

31-33

34-36

*  *  *

11

37-39

39-41

* * * * * * * *

1-6

7-12

*  *  *

13-18

19-24

*  *  *

25-30

31-36

*  *  *

37-41

* * * * * * * * * * * *

1-12

13-24

25-36

1-36

 

 

 

 

One thought on “The Oldest Known DNA Sequence

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out /  Change )

Twitter picture

You are commenting using your Twitter account. Log Out /  Change )

Facebook photo

You are commenting using your Facebook account. Log Out /  Change )

Connecting to %s